Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6280049
End position: 6280093
Length: 45

DNA sequence
>NC_020895, from 6280049 to 6280093 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCGACGAGGAGGCCGCCGTCGCGGAGGCCGCCGAGGAAGAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6279858-6280721	Sequence	SHJGH_5537 - transcription antitermination protein