Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6324643
End position: 6324687
Length: 45

DNA sequence
>NC_020895, from 6324643 to 6324687 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCCGAGGAGGCCAAGGCCGAGGAGACCACGGTCGAGGAGACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6324228-6324719	Sequence	SHJGH_5587 - 50S ribosomal protein L17