Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6436136
End position: 6436180
Length: 45

DNA sequence
>NC_020895, from 6436136 to 6436180 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCCGGAACTGACCATGCCGGAACTGACCATGCCGGAACTGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6434988-6436148	Sequence	SHJGH_5685 - acyl-CoA dehydrogenase
ORF... 6436151-6436957	Sequence	SHJGH_5686 - 4'-phosphopantetheinyl transferase