Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6496402
End position: 6496446
Length: 45

DNA sequence
>NC_020895, from 6496402 to 6496446 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGGAAGACGACGGGCAAGAAGACGCCGGGCAGGAAGACGACCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6496218-6496640	Sequence	SHJGH_5723 - hypothetical protein