Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6536444
End position: 6536488
Length: 45

DNA sequence
>NC_020895, from 6536444 to 6536488 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGTGGCGGGCGGTACGGCGGCGGGCGGTACGGCGGCGGGCGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6536105-6537463	Sequence	SHJGH_5762 - hypothetical protein