Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6567090
End position: 6567134
Length: 45

DNA sequence
>NC_020895, from 6567090 to 6567134 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCGGGGAAGCGGTCGCGGCGGAAGCGGTCGCGGGGGAGGCGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6565993-6567669	Sequence	SHJGH_5791 - hypothetical protein