Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6638054
End position: 6638098
Length: 45

DNA sequence
>NC_020895, from 6638054 to 6638098 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GAAGGCCGGACCCGTGAAGGCCGAATCCGTGAAGGCCGAGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6638068-6638637	Sequence	SHJGH_5859 - hypothetical protein