Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6719311
End position: 6719355
Length: 45

DNA sequence
>NC_020895, from 6719311 to 6719355 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGTCAGCGGGGTCCGGTTCAGCGGGGTCCGGCTCAGTGGGGTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6719220-6720617	Sequence	SHJGH_5936 - integral membrane transport protein (Protein is coded in complementary strand; from 6720617 to 6719220)