Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6730966
End position: 6731010
Length: 45

DNA sequence
>NC_020895, from 6730966 to 6731010 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCCCCGCGCAGGACGGCCCCGTGCAGGACGAACCCGCGCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6729726-6731024	Sequence	SHJGH_5945 - biotin carboxylase-like protein