Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7054863
End position: 7054907
Length: 45

DNA sequence
>NC_020895, from 7054863 to 7054907 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCCCGGCTCTCACAGTCCCGGCTCTCACAGTCCCGGTTCTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7054905-7055789	Sequence	SHJGH_6231 - ABC transporter integral membrane protein (Protein is coded in complementary strand; from 7055789 to 7054905)