Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7277851
End position: 7277895
Length: 45

DNA sequence
>NC_020895, from 7277851 to 7277895 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCGCCGCGAAGAAGACCACGGCGAAGAAGGCTCCCGCCAAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7277399-7278064	Sequence	SHJGH_6427 - histone-like DNA binding protein