Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7345526
End position: 7345570
Length: 45

DNA sequence
>NC_020895, from 7345526 to 7345570 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGGCTCCGGCCGCCGAGGCTCCGGCCGCTGAGGCTCCGGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7344701-7345588	Sequence	SHJGH_6487 - 30S ribosomal protein S2