Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7427638
End position: 7427682
Length: 45

DNA sequence
>NC_020895, from 7427638 to 7427682 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCCGGCATGGGCTGGCCGGGCATGGGCTGTCCGGGCATGGCCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7427341-7428663	Sequence	SHJGH_6561 - hypothetical protein (Protein is coded in complementary strand; from 7428663 to 7427341)