Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7484331
End position: 7484375
Length: 45

DNA sequence
>NC_020895, from 7484331 to 7484375 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGGAAAGCCCCGGCCAGGAAGGCGCCCGCCAAGAAGGCCCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7484251-7484463	Sequence	SHJGH_6599 - DNA translocase ftsK (Protein is coded in complementary strand; from 7484463 to 7484251)