Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7536114
End position: 7536158
Length: 45

DNA sequence
>NC_020895, from 7536114 to 7536158 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGCCTCTCTGACGACCGCCTCTCCGGCGACCGCCTCTCCGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7535945-7536583	Sequence	SHJGH_6649 - transmembrane protein