Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7578908
End position: 7578952
Length: 45

DNA sequence
>NC_020895, from 7578908 to 7578952 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGGTCGCCAAGAAGGCGGTCGCGAAGAAGACGGCCGCCAAGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7578476-7580017	Sequence	SHJGH_6680 - RNA polymerase sigma factor RpoD