Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7810482
End position: 7810526
Length: 45

DNA sequence
>NC_020895, from 7810482 to 7810526 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCTGACGGATCGGCCGCTGAAGGCACGGCCGCTGACGGCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7810361-7811230	Sequence	SHJGH_6865 - secreted protein (Protein is coded in complementary strand; from 7811230 to 7810361)