Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8190054
End position: 8190098
Length: 45

DNA sequence
>NC_020895, from 8190054 to 8190098 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GACGGCGGCCAAGAAGGCCCCGGCCAAGAAGGCGGCGGCCAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8189519-8190202	Sequence	SHJGH_7221 - hypothetical protein