Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8204843
End position: 8204887
Length: 45

DNA sequence
>NC_020895, from 8204843 to 8204887 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCTACCGGCTGTTCGGCCACCGGCTGTTCTCCTACCGGCGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8203972-8204916	Sequence	SHJGH_7239 - hypothetical protein