Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8425302
End position: 8425346
Length: 45

DNA sequence
>NC_020895, from 8425302 to 8425346 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CACATGGGACCGGACCACACGGGTGCGGACCACATGGGCGCGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8423317-8425629	Sequence	SHJGH_7430 - sensor-like histidine kinase