Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9013089
End position: 9013133
Length: 45

DNA sequence
>NC_020895, from 9013089 to 9013133 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGCCGCCGATCGGTCCGCTGTCGATCCGTCCGTTGCCGGTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8994909-9014936	Sequence	SHJGH_7890 - non-ribosomal peptide synthase