Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9279342
End position: 9279386
Length: 45

DNA sequence
>NC_020895, from 9279342 to 9279386 (45 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTCGCGTCGAGGGCCGTCGCGTCGAGGGCCGTCGCCTCGATGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9278133-9280271	Sequence	SHJGH_8132 - putative serine/threonine protein kinase (Protein is coded in complementary strand; from 9280271 to 9278133)