Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8969595
End position: 8969642
Length: 48

DNA sequence
>NC_020895, from 8969595 to 8969642 (48 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCCGCTGACCGGTCCCCCCACCGACCGGTCTCCCCACCGACCGGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 8968197-8969603	Sequence	SHJGH_7884 - hypothetical protein