Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2331959
End position: 2332009
Length: 51

DNA sequence
>NC_020895, from 2331959 to 2332009 (51 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCAGTGCGGGTCCGCTGTCGGTGCTGGTCCGCCGTCAGTGCTGGTCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2331996-2332346	Sequence	SHJGH_1942 - hypothetical protein (Protein is coded in complementary strand; from 2332346 to 2331996)