Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 824229
End position: 824279
Length: 51

DNA sequence
>NC_020895, from 824229 to 824279 (51 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CACCCTCGCCTGAGGACATCCCTCGCCTGAGGACATCCCTCGCCCGAGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 823820-824242	Sequence	SHJGH_0701 - hypothetical protein