Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2180181
End position: 2180234
Length: 54

DNA sequence
>NC_020895, from 2180181 to 2180234 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ATGCCGAAGGACTCACCCATGCCGAAGGACTCCCCTACGCCGAAGCTCTCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2180082-2180201	Sequence	SHJGH_1794 - hypothetical protein (Protein is coded in complementary strand; from 2180201 to 2180082)
ORF... 2180200-2180571	Sequence	SHJGH_1793 - hypothetical protein