Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2586292
End position: 2586345
Length: 54

DNA sequence
>NC_020895, from 2586292 to 2586345 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGGCTTGGCGCTCCCGCCGGGCTTGGCGCTCCCCCCGGGCCTGGTGCTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2585893-2587206	Sequence	SHJGH_2168 - hypothetical protein (Protein is coded in complementary strand; from 2587206 to 2585893)