Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3352659
End position: 3352712
Length: 54

DNA sequence
>NC_020895, from 3352659 to 3352712 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCTTCCCCGGGTGACCGGGGTGGCCCGGGTGACCGGGGTGCCCCGGATGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3352386-3353186	Sequence	SHJGH_2878 - secreted protein (Protein is coded in complementary strand; from 3353186 to 3352386)