Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3486833
End position: 3486886
Length: 54

DNA sequence
>NC_020895, from 3486833 to 3486886 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTCGCCACCACGCCGGTCGTCGCCGCCACGCCGGTCGTCGCCGCCACGCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3486195-3487061	Sequence	SHJGH_3006 - hypothetical protein