Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 427319
End position: 427372
Length: 54

DNA sequence
>NC_020895, from 427319 to 427372 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTTCCTGTGCCGCCGCCGGTTCCCGTGCCGCCGCCGGTTCCTGTGCCGCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 426376-429318	Sequence	SHJGH_0346 - putative regulatory protein (Protein is coded in complementary strand; from 429318 to 426376)