Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6871047
End position: 6871100
Length: 54

DNA sequence
>NC_020895, from 6871047 to 6871100 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCCGGCGCCCGCACCAGCCCCGGCCCCCGTACCCGCTCCGACGCCCGTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6870425-6872110	Sequence	SHJGH_6064 - hypothetical protein