Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7023045
End position: 7023098
Length: 54

DNA sequence
>NC_020895, from 7023045 to 7023098 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGTCGCCAGGACCGGCAGGACCGGCAGGACCGGCAGGACCGCCAGGACCGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7022359-7024401	Sequence	SHJGH_6199 - transcription termination factor Rho