Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8191269
End position: 8191322
Length: 54

DNA sequence
>NC_020895, from 8191269 to 8191322 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GAGGCCGAGGAAGGCGAGGAGGCCGAGGAAGGCGAGGAGGGCGAAGAAGACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8190199-8191398	Sequence	SHJGH_7222 - hypothetical protein