Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8346208
End position: 8346261
Length: 54

DNA sequence
>NC_020895, from 8346208 to 8346261 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCCCCGCCCGAGCCGCCGCTCCCGCCCGAGCCGCCGCTCTCGCCCGAGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8345642-8346763	Sequence	SHJGH_7362 - hypothetical protein (Protein is coded in complementary strand; from 8346763 to 8345642)