Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8657654
End position: 8657707
Length: 54

DNA sequence
>NC_020895, from 8657654 to 8657707 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGGAACGGGAACTTCAACGGGAACGGGAACTTCAACGGGAACGGCCACTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8657471-8658364	Sequence	SHJGH_7634 - integral membrane protein