Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8969454
End position: 8969507
Length: 54

DNA sequence
>NC_020895, from 8969454 to 8969507 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGCGCCGGTGACCAGGCGGGCGCGGGCGACCAGGCCGGCGCCGGTCACCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8968197-8969603	Sequence	SHJGH_7884 - hypothetical protein