Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9227545
End position: 9227598
Length: 54

DNA sequence
>NC_020895, from 9227545 to 9227598 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCTTCGCGTCCGCATCCGCCTTCGCATCCGTGTCCGCCTTCGCGTCCGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9227527-9228795	Sequence	SHJGH_8085 - putative transporter (Protein is coded in complementary strand; from 9228795 to 9227527)