Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9450908
End position: 9450961
Length: 54

DNA sequence
>NC_020895, from 9450908 to 9450961 (54 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CACGAGCGGCCCCGCGACCACGACCAACCCCGCGACCACGAGCGCCCCCGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9450514-9451239	Sequence	SHJGH_8290 - hypothetical protein (Protein is coded in complementary strand; from 9451239 to 9450514)