Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5909210
End position: 5909266
Length: 57

DNA sequence
>NC_020895, from 5909210 to 5909266 (57 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CAGGGCTGAGCGACTGGTTCCGGGCTGAGCGACTGGTCCGGGGCTGGGTGACTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5908752-5909219	Sequence	SHJGH_5194 - hypothetical protein