Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2084823
End position: 2084882
Length: 60

DNA sequence
>NC_020895, from 2084823 to 2084882 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCCAAGAAGACGGTGGCCAAGAAGACGGCGACGAAGAAGGCGGTGGCGAAGAAGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2084534-2085199	Sequence	SHJGH_1703 - putative regulatory protein