Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2501469
End position: 2501528
Length: 60

DNA sequence
>NC_020895, from 2501469 to 2501528 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCGTCCGGGCGCTCGCCGTCTGGGCGCTCGCCGTCCGGGCGCTCGCCGTCCGGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2500975-2501616	Sequence	SHJGH_2097 - hypothetical protein (Protein is coded in complementary strand; from 2501616 to 2500975)