Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3756742
End position: 3756801
Length: 60

DNA sequence
>NC_020895, from 3756742 to 3756801 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCGCTCCCGCTCCGTGCGCTCCTGCTCCGTGCGCTCCCGCTCCGCCCGCTCCTACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3756797-3759289	Sequence	SHJGH_3257 - aminopeptidase (Protein is coded in complementary strand; from 3759289 to 3756797)