Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3830289
End position: 3830348
Length: 60

DNA sequence
>NC_020895, from 3830289 to 3830348 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGGCCGCCCATCGGACCGCCCATGGGGCCACCCATGGGACCGCCCATCGGGCCGCCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3829678-3830805	Sequence	SHJGH_3322 - hypothetical protein (Protein is coded in complementary strand; from 3830805 to 3829678)