Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3922558
End position: 3922617
Length: 60

DNA sequence
>NC_020895, from 3922558 to 3922617 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ATGCTCGCGCTTCCCTAGTAGGGCTCGCGCTTCCCCAGTAAGGCTCGCGCCTGCCCAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3921392-3922576	Sequence	SHJGH_3407 - quinolinate synthetase