Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4065919
End position: 4065978
Length: 60

DNA sequence
>NC_020895, from 4065919 to 4065978 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACGGCCTGTTGTCCGGGCGAGTGGCCTGTTGTTCTGGCGAACGGCCTGTTGTTCGGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4065543-4065920	Sequence	SHJGH_3542 - hypothetical protein
ORF... 4065978-4066127	Sequence	SHJGH_3543 - hypothetical protein