Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5305215
End position: 5305274
Length: 60

DNA sequence
>NC_020895, from 5305215 to 5305274 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGAGCCGTCCTTCAGGGTGCCGTCCGTCAGGGAGCCGTCCGTCAGGGAGCCGTCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5304557-5305999	Sequence	SHJGH_4651 - glycosyltransferase (Protein is coded in complementary strand; from 5305999 to 5304557)