Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6536423
End position: 6536482
Length: 60

DNA sequence
>NC_020895, from 6536423 to 6536482 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGGGGCGGCGGCGGCCGGTGCGGTGGCGGGCGGTACGGCGGCGGGCGGTACGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6536105-6537463	Sequence	SHJGH_5762 - hypothetical protein