Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7982570
End position: 7982629
Length: 60

DNA sequence
>NC_020895, from 7982570 to 7982629 (60 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGTAGTCATGGCCCCCGTAGTCGTGCCCGCCGTGGCCGTGGCCCCCGTGGTCGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7982537-7983232	Sequence	SHJGH_7021 - hypothetical protein (Protein is coded in complementary strand; from 7983232 to 7982537)