Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2686782
End position: 2686844
Length: 63

DNA sequence
>NC_020895, from 2686782 to 2686844 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CACCGCCGGCCGGCCCCCGCTCGTCATCGGCCGGCCCCCGCTCCTCGTCGGCCGACCCCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2685089-2687587	Sequence	SHJGH_2251 - integral membrane protein (Protein is coded in complementary strand; from 2687587 to 2685089)