Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4406589
End position: 4406651
Length: 63

DNA sequence
>NC_020895, from 4406589 to 4406651 (63 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGACGGCCTCCGGCGCCTCCTCGACGGCCTCCGGCGCCTCCTCGACGGCCTCAGGGGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4403104-4407519	Sequence	SHJGH_3858 - hypothetical protein (Protein is coded in complementary strand; from 4407519 to 4403104)